Loading ...
the mapcreatingthree markers
in the variable region of TCRβ(passive) were discoveredThree markers
into a concrete slab(passive) have been setThree markers
Jason Sayre and Matthew Martin eachcontributedthree markers
Case Matheiscontributedthree markers
for two SNPs in the eIF4E gene of the bc-3 locus(passive) were designedThree markers
the catalyst - from the back endsettingup three markers
Bradley Gibbs , Trey Tucker and Zavery McNeill eachcontributedthree markers
Haiden Englishcontributedthree markers
Parker Rairden and Matthew Martin eachcontributedthree markers
Senior Kristen Palmer ( East Dorset , Vt./Burr and Burton Academycontributedthree markers
junior attacker Brooke Wayte ( Bellport , NYcontributedthree markers
Tianna Qualls and Leia Moore eachcontributedthree markers
under different channelscreatedunder different channels
Miscellaneous Matrix and Vector Calculations COMPANG - Compute the ( 2-D or 3-D ) angle(passive) created byMiscellaneous Matrix and Vector Calculations COMPANG - Compute the ( 2-D or 3-D ) angle
at especially prominent points or turning pointssetat especially prominent points or turning points
to SafetyPostedLeadto SafetyPosted
from cattleoriginatedfrom cattle
from MDAresultingfrom MDA
for this study in the vicinity of TTC21B and named according to their genomic position ( CA-166771200 : Fwd - GTATGCTTCTATGTTTACCCTT and Rev - CTGATGCCCTTATGAGTTAwere ... designedfor this study in the vicinity of TTC21B and named according to their genomic position ( CA-166771200 : Fwd - GTATGCTTCTATGTTTACCCTT and Rev - CTGATGCCCTTATGAGTTA
a first rigid body for the wrist ... and three additional trackers create a rigid body for the fingercreatea first rigid body for the wrist ... and three additional trackers create a rigid body for the finger
from published resourcesdesignedfrom published resources
triangularlysettriangularly
doctors to believe he potentially had Down syndromeleadingdoctors to believe he potentially had Down syndrome
at the aortic annulus aligned along a straight linesetat the aortic annulus aligned along a straight line
weaning weight performanceinfluencingweaning weight performance