Loading ...
A SNP in the F5 genecausesFactor V Leiden thrombophilia.[40
a specific mutation in the F5 or Factor V gene(passive) is caused byFactor V Leiden thrombophilia
A SNP in the F5 genecausesFactor V Leiden thrombophilia.[36
A SNP in the F5 genecausesFactor V Leiden thrombophilia.[42
A particular mutation in the f5 genecausesfactor v leiden thrombophilia
A SNP in the F5 genecausesFactor V Leiden thrombophilia
Other genetic variants of the Factor V gene that are not detected in the assaymay influenceFactor V activity
Other genetic variants of the Factor V gene that are not detected in the assaymay influenceFactor V activity
the mutationcausesfactor V Leiden thrombophilia
the case of itemscomposeFactor V. Table
by a single point mutation(passive) is causedFactor V Leiden mutation
A SNP in de F5 genecausesFactor V Leiden drombophiwia.[36
A SNP in de F5 genecausesFactor V Leiden drombophiwia.[42
one wrong letter in this section of DNAcausesFactor V Leiden ... GCAAGAACTGCAGGGGAGGAGGACGCTGCCACCCACAGCCTCTAGAGCTCATTGCAGCTGGGACAGCCCGGAGTGTGGTTATGTTTGGGCTATTATCTAATGCTGTGTAGAAATATTAAAACCCCTGTTATTTTGAAATAAAAAAGATACCCACTTTT
A SNP in de F5 genecausesFactor V Leiden drombophiwia
The mutant factor Vresultstermed factor V Leiden
Any of these indicators of unusual venous thrombosisshould promptconsideration of factor V Leiden
A variant of factor Vcausesfactor V Leiden
by a mutation in the F5 gene(passive) is caused byFactor V Leiden
a mutation in the F5 gene(passive) is caused byFactor V Leiden
A SNP in de F5 genecausesFactor V Leiden
A SNP in the F5 genecausesFactor V Leiden
first(passive) was ... discoveredFactor V Leiden
People with activated protein C resistanceusually resultingfrom factor V Leiden
A factor V genetic component differing fromcontributesfactor V R506Q
the hypercoagulable stateresultingfrom Factor V Leiden
A history of unexplained venous thrombosis in a patient less than 50 years of age with a family history of venous thrombosisshould promptconsideration for factor V Leiden
most commonly(passive) is ... discoveredFactor V Leiden
amino acid 506resultingin Factor V Leiden
by filtration(passive) led byFactor v
a substitution of glutamine for arginine at amino acid 506resultingin Factor V Leiden
Factorsinfluencingfactor vegf
Operating characteristicinfluencingfactor s
The Diamond Jewelry market report has studied key opportunities in the market andinfluencingfactor which is
The EV Bus market report has studied key opportunities in the market andinfluencingfactor which is
general consensus consensus ... continue ... reason , cause controversial issue issue cooperate together cooperate ( or replace with simpler helpcontributingfactor factor
Rates and Ratios : Fertility , MortalityinfluencingFactor s
via the many yearshave discoveredvia the many years
in thrombophiliaresultsin thrombophilia
in 1994was discoveredin 1994
resistance to activated protein Ccausingresistance to activated protein C
resistance to activated protein C ( APCcausesresistance to activated protein C ( APC
factor V deficiency or parahemophilia , which is a rare bleeding disordercausesfactor V deficiency or parahemophilia , which is a rare bleeding disorder
to thrombophiliamay leadto thrombophilia
to activated protein Ccausingto activated protein C
resistance to degradationcausesresistance to degradation
APC resistance(passive) caused byAPC resistance
a hypercoagulability disordercausesa hypercoagulability disorder
a hypercoagulability disordercausesa hypercoagulability disorder
a poor anticoagulant response to activated protein C.causesa poor anticoagulant response to activated protein C.
to excessive blood clotting Blood clottingleadsto excessive blood clotting Blood clotting
blood clotscausesblood clots
central retinal vein occlusion in a young patientmay causecentral retinal vein occlusion in a young patient
activated protein C ( APC ) which prevents clots from growing too large , to be unable to inactivate one of the important clotting factors , factor V , normally , resulting in increased risks of micro - clotscausingactivated protein C ( APC ) which prevents clots from growing too large , to be unable to inactivate one of the important clotting factors , factor V , normally , resulting in increased risks of micro - clots
in 1994was discoveredin 1994
an increase in blood clottingcausesan increase in blood clotting
to the creation of blood clotscontributesto the creation of blood clots
a small amount of riskmay contributea small amount of risk
a patient with Budd - Chiari syndrome(passive) caused bya patient with Budd - Chiari syndrome
activated protein C resistancecausesactivated protein C resistance
resistance to activated protein C ( APC resistance(passive) caused byresistance to activated protein C ( APC resistance
activated protein C(passive) caused byactivated protein C
activated protein C resistance ( APCRcausesactivated protein C resistance ( APCR
from a point mutation in the gene coding for factor V ... for the increased tendency toward venous thrombosisresultsfrom a point mutation in the gene coding for factor V ... for the increased tendency toward venous thrombosis
protein C(passive) caused byprotein C
C resistance(passive) caused byC resistance
The slow anti - clotting response(passive) caused byThe slow anti - clotting response
The slow anti - clotting response(passive) caused byThe slow anti - clotting response
Resistance(passive) caused byResistance
to resistanceleadsto resistance
my body to clot faster than normalcausedmy body to clot faster than normal
problems(passive) caused byproblems
to complications in pregnancycan leadto complications in pregnancy
thrombosiscausesthrombosis
to thrombosismay contributeto thrombosis
to an increased risk of thrombosisleadsto an increased risk of thrombosis
an increased risk of thrombosiscausesan increased risk of thrombosis