Loading ...
using Primer Express 2.0 software ( applied Biosystems(passive) were designedqPCR primers
to span the promoter and exonic regions of three candidate genes ( Drd2 , Drd4 , and Dat1 ) using Primer Express software ( Applied Biosystems , Foster City , CA , USA(passive) were designed/ BLAST/. Primers
using DNA sequence homology for various HPV types indicated within the highly conserved region of the L1 region(passive) were designedPGMY09/11 primers
using the Primer Express Software v 2.0(passive) were designedQPCR primers
according to : GACTTGCGTGACTATGAAGC , TGACGGTTCTGAGGAGTAGA using Invitrogen custom primer design software ( Invitrogen , Inc.(passive) were designedChitinase-3 primers
using Primer3 software ( http://frodo.wi.mit.edu / primer3/(passive) were designedqPCR primers
from conserved regions of fungal 25S and 18S genes(passive) were designed295.Two primers
with Primer Express Software 3.0 ( Applied Biosystems(passive) were designedTaqman primers
to specifically amplify coding transcripts ( Additional file 1 : Table S1(passive) were designedQPCR primers
using Primer 5(passive) were designedqPCR primers
using primer3 to give products of approximately 75 - 150 bases in length ( Additional file 19(passive) were designedqPCR primers
Different primer design tools can be usedto designqPCR primers
using PyroMark Assay Design Software 2.0 ( Qiagen(passive) were designedPyrosequencing primers
using the online RealTimePCR Tool with default parameters ( Integrated DNA Technologies , IA , USA(passive) were designedQPCR primers
using PrimerQuest Tool ( Integrated DNA Technologies(passive) were designedSYBR primers
to amplify the mRNA transcript outside the dsRNA region(passive) were designedqPCR primers
using Primer3 ( Electronic supplementary material ( ESM ) Table 1 and Fig . 1a(passive) were designedqPCR primers
to anneal on different exons(passive) were designedqPCR primers
to detect expression from all Hsp70 gene copies(passive) were designedHsp70 primers
according to : ATGACATCAAGAAGGTGGTG(passive) were designedGAPDH primers
to detect the normally processed mRNA , where one primer in each set hybridizes to the normal but not the abnormally processed transcript(passive) are designedqPCR primers
that was writtento designqPCR primers
are commoncausingblown primers
to generate a 635-bp product(passive) were designedGAPDH primers
I customdesignedTaqman primers
as 5'-GCGGGGCTCCAGAACATCAT-3(passive) were designedGAPDH primers
so that marker points were amplified as 4 overlapping areas within the gag region of HIV-1(passive) were designedBarcoded primers
The most important one that makes it simple from others technique , the genome specific sequence of the target organism is not requiredto designRAPD primers
head spacecan causeblown primers
Excessive head spacewill causeblown primers
for the above 6 transcripts along with the housekeeping genes , elongation initiation factor 4a ( ELF4A ) and actin(passive) were designedqPCR primers
to detect these two novel SNPs ( G316A and G908A ) in 22 registered rapeseed varieties(passive) were designedAllelic primers
This actionmay also causeblown primer
in jamming of the weaponresultingin jamming of the weapon
to amplify the 9 coding exons of the HMGCL gene ( primer sequences available on requestdesignedto amplify the 9 coding exons of the HMGCL gene ( primer sequences available on request
to intronic sequences of housekeeping genes to confirm the absence of genomic DNA and RT - PCR to detect human cDNA sequences that do not co - amplify processed pseudogenesdesignedto intronic sequences of housekeeping genes to confirm the absence of genomic DNA and RT - PCR to detect human cDNA sequences that do not co - amplify processed pseudogenes
according to the genomic sequence of the genedesignedaccording to the genomic sequence of the gene
based on bovine genomic sequencesdesignedbased on bovine genomic sequences
for human IL-10 ( Search LC , GmbH Heidelberg , Germanysetfor human IL-10 ( Search LC , GmbH Heidelberg , Germany
to amplify the coding region of HPSE based on EST sequences for the pigdesignedto amplify the coding region of HPSE based on EST sequences for the pig
according to the sequences of known regions of individual genesdesignedaccording to the sequences of known regions of individual genes
to amplify across the regions where the different fragments were annealed , followed by DNA sequencingdesignedto amplify across the regions where the different fragments were annealed , followed by DNA sequencing
for the GenBank sequences to amplify cDNA from reverse transcribed human skeletal muscle RNAdesignedfor the GenBank sequences to amplify cDNA from reverse transcribed human skeletal muscle RNA
to specifically amplify regions of mitochondrial introns , exons , and intron - exon or exon - exon junctions indesignedto specifically amplify regions of mitochondrial introns , exons , and intron - exon or exon - exon junctions in
according to genomic and available EST sequences in GenBankdesignedaccording to genomic and available EST sequences in GenBank
to amplify sequence within the endogenous * F - box * genedesignedto amplify sequence within the endogenous * F - box * gene
to amplify the polymorphic ( CA)n repeat region of human IGF-1 genedesignedto amplify the polymorphic ( CA)n repeat region of human IGF-1 gene
to amplify possible CP - sHSP gene family members were based on the sequence of gene ApHsp26 ( GenBank accession nodesignedto amplify possible CP - sHSP gene family members were based on the sequence of gene ApHsp26 ( GenBank accession no
to flank the splice junctions of each coding amplicon of the MKKS genedesignedto flank the splice junctions of each coding amplicon of the MKKS gene
on the basis of a previously published sequence of the gene ( Dehesh et al .designedon the basis of a previously published sequence of the gene ( Dehesh et al .
with Primer3 ( S2 Tabledesignedwith Primer3 ( S2 Table
within the introns flanking each exon from the published AIRE gene sequence ( GeneBank accession number : AB00684designedwithin the introns flanking each exon from the published AIRE gene sequence ( GeneBank accession number : AB00684
at the intron and exon sequences of each regiondesignedat the intron and exon sequences of each region
for real - time PCR and a TaqMan probedesignedfor real - time PCR and a TaqMan probe
for detection of 5 common PIK3CA mutations based on ARMS PCR ( amplification refractory mutation specific PCR ) and double circular probe detection technologydesignedfor detection of 5 common PIK3CA mutations based on ARMS PCR ( amplification refractory mutation specific PCR ) and double circular probe detection technology
to amplify the coding sequences of the PAC and Bar genes , respectivelydesignedto amplify the coding sequences of the PAC and Bar genes , respectively
on the basis of the alignment of conserved sequences from the alkB gene region from different n - alkane degrading Rhodococcus bacteriadesignedon the basis of the alignment of conserved sequences from the alkB gene region from different n - alkane degrading Rhodococcus bacteria
for N. benthamianadesignedfor N. benthamiana
for the most conserved regions of these genesdesignedfor the most conserved regions of these genes
on basis the gene sequencesdesignedon basis the gene sequences
to amplify Nos2 and Tnf genes , promoters and flanking regionsdesignedto amplify Nos2 and Tnf genes , promoters and flanking regions
to amplify the genomic regions that are bound and run the productsare designedto amplify the genomic regions that are bound and run the products
to amplify fragments within the NC1 regiondesignedto amplify fragments within the NC1 region
to the 18S rRNA gene ( GenBank accessiondesignedto the 18S rRNA gene ( GenBank accession
for the PCR amplification of microbial sequencesdesignedfor the PCR amplification of microbial sequences
respectively based on the EST sequencedesignedrespectively based on the EST sequence
to amplify in the promoter , 16S , or 23S subunit genes from all seven rRNA operonsdesignedto amplify in the promoter , 16S , or 23S subunit genes from all seven rRNA operons
from conserved sequences of RNA - dependent RNA - polymerase genes of the Rhabdoviridaedesignedfrom conserved sequences of RNA - dependent RNA - polymerase genes of the Rhabdoviridae
using genomic sequence informationdesignedusing genomic sequence information
to amplify a specific HCV genotype or degenerate primers to amplify multiple genotypesdesignedto amplify a specific HCV genotype or degenerate primers to amplify multiple genotypes
to amplify genomic DNA sequences coding for the putative cleavage site for taspase 1designedto amplify genomic DNA sequences coding for the putative cleavage site for taspase 1
to amplify a region of exon 2 including known polymorphic sites at amino acid positions 72 , 74 , 75 and 76designedto amplify a region of exon 2 including known polymorphic sites at amino acid positions 72 , 74 , 75 and 76
from respective fungal and plant gene sequencesdesignedfrom respective fungal and plant gene sequences